Sequence ID | >WENV170652227 |
Genome ID | JRYH01000147 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 64672 |
End posion on genome | 64587 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
ttcactcgcc |
tRNA gene sequence |
GCCCGCATGGTGAAATGGTAAACACAGCAGACTTAAAATCTGCCGCCCGCAAGGGCTTCC |
Downstream region at tRNA end position |
tcgctcatat |
Secondary structure (Cloverleaf model) | >WENV170652227 Leu TAA c ACCA tcgctcatat G - C C - G C - G C - G G - C C - G A - T T G T G G G C C A T A A G | | | | | A G A G T G C C C G G C G | | | T T T A C A C A A A CGCCCGCAAGGGCTT G - C C - G A - T G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |