Sequence ID | >WENV170652230 |
Genome ID | JRYH01000179 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 26640 |
End posion on genome | 26730 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
ttcgcgcgct |
tRNA gene sequence |
GGAGACGTGGCCGAGAGGCTGAAGGCGGCGGTTTGCTAAATCGTTATACCCCCAAAGGGT |
Downstream region at tRNA end position |
agcgattnnn |
Secondary structure (Cloverleaf model) | >WENV170652230 Ser GCT t GCCA agcgattnnn G - C G - C A - T G - C A - T C - G G - C T A T T C C C C A A G A G | | | | | G G G C C G A G G G G C G | | | T T C A G G C T G A G TATACCCCCAAAGGGTATC G + T C - G G - C G + T T - A T A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |