Sequence ID | >WENV170652233 |
Genome ID | JRYH01000193 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 17225 |
End posion on genome | 17150 |
Amino Acid | Glu |
Anticodon | CTC |
Upstream region at tRNA start position |
tatacggccc |
tRNA gene sequence |
GCTCCCTTCGTCTAGTGGCCCAGGACGTCGCCCTCTCAAGGCGAAAACACGAGTTCGAGT |
Downstream region at tRNA end position |
gtttgcgcct |
Secondary structure (Cloverleaf model) | >WENV170652233 Glu CTC c GCCA gtttgcgcct G - C C - G T - A C - G C - G C - G T - A T G T T G C T C A T G A C | | | | | G G T C T G A C G A G C G + | | | T T C G G A C C C A G AAAC T - A C - G G - C C - G C - G C A T A C T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |