Sequence ID | >WENV170652239 |
Genome ID | JRYH01000227 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 154673 |
End posion on genome | 154748 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
cccaaggtca |
tRNA gene sequence |
GGGGCCATAGCTCAGCTGGGAGAGCGCTTGCATGGCATGCAAGAGGTCAGCGGTTCGATC |
Downstream region at tRNA end position |
tttctcgtaa |
Secondary structure (Cloverleaf model) | >WENV170652239 Ala GGC a ACCA tttctcgtaa G - C G - C G + T G - C C - G C - G A - T C T T T C G C C A C G A A | | | | | G T C T C G A G C G G C G | | | | T T G G A G C G A G AGGTC C - G T - A T - A G - C C - G A T T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |