Sequence ID | >WENV170652241 |
Genome ID | JRYH01000237 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 869 |
End posion on genome | 944 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
gacaggttac |
tRNA gene sequence |
GGGGGCATAGCTCAGTTGGGAGAGCGCGTGCTTTGCAAGCATGAGGTCGTCGGTTCGATC |
Downstream region at tRNA end position |
acggctttgt |
Secondary structure (Cloverleaf model) | >WENV170652241 Ala TGC c ACCA acggctttgt G - C G - C G + T G - C G - C C - G A - T C T T C T G C C A T G A A | | | | G T C T C G G T C G G C G | | | | T T G G A G C G A G AGGTC C - G G + T T - A G - C C - G T A T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |