Sequence ID | >WENV170652242 |
Genome ID | JRYH01000239 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 265 |
End posion on genome | 341 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
acaaaatcac |
tRNA gene sequence |
CGCGGGGTGGAGCAGCCCGGTAGCTCGTCAGGCTCATAACCTGAAGGTCACAGGTTCAAA |
Downstream region at tRNA end position |
atcatctgtc |
Secondary structure (Cloverleaf model) | >WENV170652242 Met CAT c ACCA atcatctgtc C A G - C C - G G - C G - C G - C G - C T A T C G T C C A C G A G | | | | A C C G A G A C A G G C C | | | | T T G G C T C G T A G AGGTC T - A C - G A - T G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |