Sequence ID | >WENV170652248 |
Genome ID | JRYH01000303 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 63498 |
End posion on genome | 63570 |
Amino Acid | Glu |
Anticodon | CTC |
Upstream region at tRNA start position |
tctgagcgct |
tRNA gene sequence |
GTCCCGTTCGTCTAGTGGCCTAGGACACCAGCCTCTCACGTTGGGAACAGGGGTTCGAGT |
Downstream region at tRNA end position |
nnnnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV170652248 Glu CTC t Tnnn nnnnnnnnnn G - C T + G C - G C - G C - G G - C T - A T G T T C C C C A T G A C | | | | | G G T C T G A G G G G C G + | | | T T C G G A C C T A A GAAC C - G C - G A - T G + T C - G C C T A C T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |