Sequence ID | >WENV170652252 |
Genome ID | JRYH01000325 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 106082 |
End posion on genome | 106158 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
gaatggaaat |
tRNA gene sequence |
GCGGGCGTAGCTCAGTTGGTTAGAGCGCCGGCCTGTCACGCCGGAGGCCGCGGGTTCAAG |
Downstream region at tRNA end position |
ttccctcaac |
Secondary structure (Cloverleaf model) | >WENV170652252 Asp GTC t GCCA ttccctcaac G - C C - G G - C G + T G - C C - G G - C T G T T G C C C A T G A A + | | | | A T C T C G G C G G G C G | | | | T T G G A G C T T A G AGGCC C - G C - G G - C G - C C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |