Sequence ID | >WENV170652253 |
Genome ID | JRYH01000325 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 114362 |
End posion on genome | 114278 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
cgcggcacct |
tRNA gene sequence |
GCGGGCGTGGTGGAATTGGTAGACACGCCAGATTTAGGTTCTGGTGGCCTTGGCCGTGGG |
Downstream region at tRNA end position |
gtgctcctta |
Secondary structure (Cloverleaf model) | >WENV170652253 Leu TAG t ACCA gtgctcctta G - C C - G G - C G - C G - C C - G G - C T G T C T C C C A T A A G | + | | | A T G G T G G G G G G C G | | | T T G A C A C T A G G TGGCCTTGGCCGT C - G C - G A - T G - C A - T T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |