Sequence ID | >WENV170652259 |
Genome ID | JRYH01000373 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 7326 |
End posion on genome | 7412 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
ccctcttccg |
tRNA gene sequence |
GCCGGGATGGCGGAATTGGTAGACGCGCCGGACTCAAAATCCGGTACTGGCGACAGTGTG |
Downstream region at tRNA end position |
tcatcggcac |
Secondary structure (Cloverleaf model) | >WENV170652259 Leu CAA g ACCA tcatcggcac G - C C - G C - G G - C G - C G - C A - T T G T C T C C C A T A A G | | | | A T G G C G G T G G G C G | | | T T G A C G C T A G G TACTGGCGACAGTGT C - G C - G G - C G - C A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |