Sequence ID | >WENV170652261 |
Genome ID | JRYH01000398 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 31163 |
End posion on genome | 31235 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
ccctcgcgga |
tRNA gene sequence |
ACGCCAGTAGCTCAATTGGTAGAGCAGCGGATTCCAAATCCGCAGGTTGGGGGTTCGAGT |
Downstream region at tRNA end position |
aagcccggcg |
Secondary structure (Cloverleaf model) | >WENV170652261 Trp CCA a Gttg aagcccggcg A - T C - G G - C C - G C - G A - T G - C T G T C T C C C A T A A A | + | | | G T C T C G G G G G G C G | | | | T T G G A G C T A A AGGTT G - C C - G G - C G - C A - T T A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |