Sequence ID | >WENV170652268 |
Genome ID | JRYH01000432 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 12520 |
End posion on genome | 12446 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
ggacggcttc |
tRNA gene sequence |
GGGCCGGTAGCTCAGCGGTAGAGCACGTGACTTTTAATCATGGGGTCGAGGGTTCGATTC |
Downstream region at tRNA end position |
tctgtctgga |
Secondary structure (Cloverleaf model) | >WENV170652268 Lys TTT c ACCA tctgtctgga G - C G + T G - C C - G C - G G - C G - C T T T C T C C C A G A A | | | | | G C C T C G G A G G G C G | | | | T T G G A G C T A A GGGTC C - G G + T T - A G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |