Sequence ID | >WENV170652274 |
Genome ID | JRYH01000478 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 46922 |
End posion on genome | 46995 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
gcccgccagc |
tRNA gene sequence |
GGGCGTGTAGCTCAGCCTGGTAGAGCACCGCATTGAAAATGCGGGTGTCGGCGGTTCAAA |
Downstream region at tRNA end position |
cgagaaggcc |
Secondary structure (Cloverleaf model) | >WENV170652274 Phe GAA c Attg cgagaaggcc G - C G - C G - C C - G G - C T + G G - C T A T C C G C C A C G A A | | | | | A C C T C G G G C G G C T | | | | T T G G A G C G T A A GTGTC C - G C - G G - C C - G A - T T A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |