Sequence ID | >WENV170652277 |
Genome ID | JRYH01000507 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 68050 |
End posion on genome | 68124 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
caggatatgt |
tRNA gene sequence |
GTCCCCTTCGTCTATCGGTTAGGACGCCAGATTTTCATTCTGGAAAGAGGAGTTCGATTC |
Downstream region at tRNA end position |
tcctgatgcc |
Secondary structure (Cloverleaf model) | >WENV170652277 Glu TTC t ACCA tcctgatgcc G + T T - A C - G C - G C - G C - G T - A T T T T C C T C A C T A C | | | | | G G T C T G A G G A G C G + | | | T T T G G A C T A G AAAG C - G C - G A - T G - C A - T T T T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |