Sequence ID | >WENV170652285 |
Genome ID | JRYH01000543 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 111075 |
End posion on genome | 111148 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
attgacaacc |
tRNA gene sequence |
GGGCCTATAGCTCAGATGGCTAGAGCGCACCCCTGATAAGGGTGAGGTCACAGGTTCGAG |
Downstream region at tRNA end position |
ccgacccgcg |
Secondary structure (Cloverleaf model) | >WENV170652285 Ile GAT c Attc ccgacccgcg G - C G - C G - C C - G C - G T - A A - T T G T T G T C C A A G A A | | | | | G T C T C G A C A G G C G | | | | T T G G A G C C T A G AGGTC C - G A - T C - G C - G C - G C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |