Sequence ID | >WENV170652286 |
Genome ID | JRYH01000543 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 148783 |
End posion on genome | 148855 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
cgcacgcgcC |
tRNA gene sequence |
AGGGCATTGGTGTAACGGTAGCACGACTGATTCTGGTTCAGTTAGTTGGGGTTCGAATCC |
Downstream region at tRNA end position |
caaaaggctg |
Secondary structure (Cloverleaf model) | >WENV170652286 Gln CTG C GTtt caaaaggctg A - T G - C G - C G - C C - G A - T T - A T A T G T C C C A A A G + + | | | G C T G T G T G G G G C G + | | | T T G G C A C T A G TAGT A - T C - G T - A G - C A - T T T T G C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |