Sequence ID | >WENV170652293 |
Genome ID | JRYH01000597 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 18755 |
End posion on genome | 18831 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
gaggtggacg |
tRNA gene sequence |
GGTCCCGTAGCTCATCAGGATAGAGCGCAAGATTCCTAATCTTGAGGTAACAGGTTCGAG |
Downstream region at tRNA end position |
ccttgcgcgt |
Secondary structure (Cloverleaf model) | >WENV170652293 Arg CCT g GCCA ccttgcgcgt G - C G + T T - A C - G C - G C - G G - C T G T T G T C C A C T A A | | | | | G A C T C G A C A G G C G | | | | T T G G A G C A T A G AGGTA C - G A - T A - T G - C A - T T A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |