Sequence ID | >WENV170652296 |
Genome ID | JRYH01000601 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 325193 |
End posion on genome | 325120 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
actccgagtt |
tRNA gene sequence |
GGCCACGTGGCGGAGTGGTGACGCAGCGGACTGCAAATCCGTATACGCCGGTTCGATTCC |
Downstream region at tRNA end position |
actcctccgg |
Secondary structure (Cloverleaf model) | >WENV170652296 Cys GCA t TCCA actcctccgg G - C G - C C - G C - G A - T C - G G - C T T T C G G C C A G A G | | | | | G T G G C G G C C G G C G | | | T T G A C G C T G A ATAC G + T C - G G - C G - C A - T C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |