Sequence ID | >WENV170652297 |
Genome ID | JRYH01000601 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 324940 |
End posion on genome | 324866 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
gatggcctgt |
tRNA gene sequence |
TCCGCGGTAGCTCAGCGGTAGAGCAACCGGCTGTTAACCGGTTGGTCGCAGGTTCGAATC |
Downstream region at tRNA end position |
tctcatccaa |
Secondary structure (Cloverleaf model) | >WENV170652297 Asn GTT t GCCA tctcatccaa T - A C - G C - G G - C C - G G - C G - C T A T C G T C C A G A A | | | | | G C C T C G G C A G G C G | | | | T T G G A G C T A A TGGTC A - T C - G C - G G - C G - C C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |