Sequence ID | >WENV170652301 |
Genome ID | JRYH01000641 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 5355 |
End posion on genome | 5429 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
gggacaactt |
tRNA gene sequence |
GGGGCGGTAGCTCAATTGGTTAGAGTACCGGACTGTCGATCCGGTGGTTGCGGGTTCGAG |
Downstream region at tRNA end position |
cctaagccct |
Secondary structure (Cloverleaf model) | >WENV170652301 Asp GTC t GCtt cctaagccct G - C G + T G - C G - C C - G G - C G - C T G T T G C C C A T A A A + | | | | G T C T C G G C G G G C G | | | + T T G G A G T T T A A TGGTT C - G C - G G - C G - C A - T C A T G G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |