Sequence ID | >WENV170652302 |
Genome ID | JRYH01000662 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 9435 |
End posion on genome | 9510 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
tctgacctca |
tRNA gene sequence |
GCCCCGGTAGCTCAGGGGATAGAGCATCCGCCTCCTAAGCGGAAGGTCGCAGGTTCGAAT |
Downstream region at tRNA end position |
aactcgcttc |
Secondary structure (Cloverleaf model) | >WENV170652302 Arg CCT a GCCA aactcgcttc G - C C - G C - G C - G C - G G - C G - C T A T C G T C C A G G A A | | | | | G G C T C G G C A G G C G | | | | T T A G A G C T A A AGGTC T - A C - G C - G G - C C - G C A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |