Sequence ID | >WENV170652305 |
Genome ID | JRYH01000678 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 4067 |
End posion on genome | 4142 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
caaactatcc |
tRNA gene sequence |
GGGGCCGTAGCTCAGTTGGGAGAGCGCTACAATGGCATTGTAGAGGTCAGGGGTTCGATT |
Downstream region at tRNA end position |
ataataagca |
Secondary structure (Cloverleaf model) | >WENV170652305 Ala GGC c ACCA ataataagca G - C G - C G + T G - C C - G C - G G - C T T T T C C C C A T G A A | | | | | G T C T C G A G G G G C G | | | | T T G G A G C G A G AGGTC C - G T - A A - T C - G A - T A T T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |