Sequence ID | >WENV170652314 |
Genome ID | JRYH01000753 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 15097 |
End posion on genome | 15173 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
cctcttcttg |
tRNA gene sequence |
GCACCCGTAGCTCAGCTGGATAGAGCGCTGCCCTCCGAAGGCAGAGGTCACACGTTCGAA |
Downstream region at tRNA end position |
gttttttctg |
Secondary structure (Cloverleaf model) | >WENV170652314 Arg CCG g GCCA gttttttctg G - C C - G A - T C - G C - G C - G G - C T A T T G T G C A C G A A | | | | | G T C T C G A C A C G C G | | | | T T G G A G C A T A G AGGTC C - G T - A G - C C - G C - G C A T A C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |