Sequence ID | >WENV170652315 |
Genome ID | JRYH01000753 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 41349 |
End posion on genome | 41274 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
ttcaggatcc |
tRNA gene sequence |
GCCGCTGTAGCTCAGTTGGTAGAGCACCGCATTCGTAATGCGTAGGTCGCCTGTTCGAGT |
Downstream region at tRNA end position |
tttccctcta |
Secondary structure (Cloverleaf model) | >WENV170652315 Thr CGT c ACCA tttccctcta G - C C - G C - G G - C C - G T - A G - C T G T C G G A C A T G A A | | | | | G T C T C G G C C T G C G | | | | T T G G A G C T A A AGGTC C T C - G G - C C - G A - T T A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |