Sequence ID | >WENV170652316 |
Genome ID | JRYH01000760 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 25658 |
End posion on genome | 25582 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
ggccgcatcc |
tRNA gene sequence |
GGGCGATTAGCTCAGTTGGTTAGAGCGCCGTCTTGACATGGCGGAGGTCACTGGTTCAAA |
Downstream region at tRNA end position |
acattcatcg |
Secondary structure (Cloverleaf model) | >WENV170652316 Val GAC c ACCA acattcatcg G - C G - C G - C C - G G - C A - T T - A T A T T G A C C A T G A A | | | | | A T C T C G A C T G G C G | | | | T T G G A G C T T A G AGGTC C - G C - G G - C T + G C - G T T T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |