Sequence ID | >WENV170652321 |
Genome ID | JRYH01000813 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 138510 |
End posion on genome | 138434 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
gccgtccgat |
tRNA gene sequence |
CGGGGCATAGCTCAGCCTGGTAGAGCACCTGCTTTGGGAGCAGGGGGTCGCGAGTTCGAA |
Downstream region at tRNA end position |
gcacgacgct |
Secondary structure (Cloverleaf model) | >WENV170652321 Pro TGG t ACCA gcacgacgct C - G G - C G - C G - C G - C C - G A - T T A T C G C C C A C G A A | | | | G C C T C G G C G A G C T | | | | T T G G A G C G T A A GGGTC C - G C - G T - A G - C C - G T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |