Sequence ID | >WENV170652323 |
Genome ID | JRYH01000827 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 4804 |
End posion on genome | 4879 |
Amino Acid | Lys |
Anticodon | CTT |
Upstream region at tRNA start position |
tccctcttgt |
tRNA gene sequence |
GGGCGCTTAGCTCAGTTGGTAGAGCAGCTGACTCTTAATCAGCGGGTCACAGGTTCGAAT |
Downstream region at tRNA end position |
ttcacccggt |
Secondary structure (Cloverleaf model) | >WENV170652323 Lys CTT t ACCA ttcacccggt G + T G - C G - C C - G G - C C - G T - A T A T T G T C C A T G A A | | | | | G T C T C G A C A G G C G | | | | T T G G A G C T A A GGGTC G - C C - G T - A G - C A - T C A T A C T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |