Sequence ID | >WENV170652324 |
Genome ID | JRYH01000850 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 4557 |
End posion on genome | 4633 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
accggcccgc |
tRNA gene sequence |
GGCCCCGTAGCTCAACGGGATAGAGCAAGCGCCTTCTAAGCGCTAGGTTGGGGGTTCGAG |
Downstream region at tRNA end position |
tctctacatt |
Secondary structure (Cloverleaf model) | >WENV170652324 Arg TCT c GCCA tctctacatt G - C G + T C - G C - G C - G C - G G - C T G T C C T C C A C A A A | | + | | G G C T C G G G G G G C G | | | | T T G G A G C A T A A AGGTT A - T G - C C - G G - C C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |