Sequence ID | >WENV170652326 |
Genome ID | JRYH01000896 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 3461 |
End posion on genome | 3545 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
gattggtcac |
tRNA gene sequence |
GGAGGGATGCCCGAGTGGCTAAAGGGGACGGACTGTAAATCCGTTGGCTTCGCCTACGCT |
Downstream region at tRNA end position |
gttccttcgc |
Secondary structure (Cloverleaf model) | >WENV170652326 Tyr GTA c ACCA gttccttcgc G - C G - C A - T G - C G - C G - C A - T T A T C G A C C A T G A G | | | | | G G G C C C G C T G G C G | | | T T C A G G G T A A G TGGCTTCGCCTAC A - T C - G G - C G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |