Sequence ID | >WENV170652327 |
Genome ID | JRYH01000917 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 4296 |
End posion on genome | 4371 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
cgatccgtgt |
tRNA gene sequence |
GGGGCTATAGCTCAGCTGGGAGAGCGCTACAATGGCATTGTAGAGGTCGGCGGTTCGATC |
Downstream region at tRNA end position |
tccgcacact |
Secondary structure (Cloverleaf model) | >WENV170652327 Ala GGC t ACCA tccgcacact G - C G - C G + T G - C C - G T - A A - T C T T C C G C C A C G A A | | | | | G T C T C G G G C G G C G | | | | T T G G A G C G A G AGGTC C - G T - A A - T C - G A - T A T T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |