Sequence ID | >WENV170652328 |
Genome ID | JRYH01000917 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 4386 |
End posion on genome | 4461 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
cacactctgt |
tRNA gene sequence |
GTCCCCTTCGTCTAGAGGCCCAGGACATCGCCCTTTCACGGCGACAACAGGGGTTCGAAT |
Downstream region at tRNA end position |
tttttttcgg |
Secondary structure (Cloverleaf model) | >WENV170652328 Glu TTC t GCCA tttttttcgg G - C T - A C - G C - G C - G C - G T - A T A T T C C C C A A G A C | | | | | G G T C T G A G G G G C G + | | | T T C G G A C C C A A CAAC T - A C - G G - C C - G C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |