Sequence ID | >WENV170652333 |
Genome ID | JRYH01000957 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 132009 |
End posion on genome | 132095 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
tcgttaccgg |
tRNA gene sequence |
GCCCCTGTGGCGGAACAGGTAGACGCGGCAGACTCAAAATCTGCTGTCAGCAATGACGTG |
Downstream region at tRNA end position |
cgtttgaacg |
Secondary structure (Cloverleaf model) | >WENV170652333 Leu CAA g ACCA cgtttgaacg G - C C - G C - G C - G C - G T - A G - C T G T C G G G C A C A A G | | | | | G A G G C G G C C C G C G | | | T T G A C G C T A G G TGTCAGCAATGACGT G - C C - G A - T G - C A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |