Sequence ID | >WENV170652335 |
Genome ID | JRYH01000983 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 27764 |
End posion on genome | 27669 |
Amino Acid | SeC(p) |
Anticodon | TCA |
Upstream region at tRNA start position |
gcatgggcat |
tRNA gene sequence |
GGAGGAGTCCCGTCCCCGGTGGGGCGACCGGTCTTCAAAACCGGGTGGGGCCGTGAGACG |
Downstream region at tRNA end position |
tcctctcagc |
Secondary structure (Cloverleaf model) | >WENV170652335 SeC(p) TCA t GCCA tcctctcagc G - C G - C A - T G - C G - C A - T G - C T C T C C T A C C C A C C C C + | | | | G G C T G C G T G G G C G | + | | T T T G G C G G G A GTGGGGCCGTGAGACGGCTTCAG C - G C - G G - C G - C T - A C A T A T C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |