Sequence ID | >WENV170652344 |
Genome ID | JRYH01001062 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 5406 |
End posion on genome | 5333 |
Amino Acid | Pro |
Anticodon | CGG |
Upstream region at tRNA start position |
gattcgatga |
tRNA gene sequence |
CGGGGTGTAGCGCAGCTTGGTAGCGCGTCTCGTTCGGGACGAGAAGGTCGGAGGTTCGAA |
Downstream region at tRNA end position |
tgacaggttg |
Secondary structure (Cloverleaf model) | >WENV170652344 Pro CGG a Attc tgacaggttg C - G G - C G - C G - C G - C T - A G - C T A T T C T C C A C G A A + | | | | G T C G C G G G A G G C T | | | | T T G G C G C G T A G AGGTC T - A C - G T - A C - G G - C T A T G C G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |