Sequence ID | >WENV170652347 |
Genome ID | JRYH01001156 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 7999 |
End posion on genome | 7925 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
cccgcgccag |
tRNA gene sequence |
GCCGGCATAGCTCAGTGGTAGAGCAGCGGTTTTGTAAACCGTTGGTCGGGAGTTCAAATC |
Downstream region at tRNA end position |
gtcttttaga |
Secondary structure (Cloverleaf model) | >WENV170652347 Thr TGT g ACCA gtcttttaga G - C C - G C - G G - C G - C C - G A - T T A T C T C T C A G A A | + | | | A T C T C G G G G A G C G | | | | T T G G A G C T A A TGGTC G + T C - G G - C G - C T - A T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |