Sequence ID | >WENV170652349 |
Genome ID | JRYH01001318 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 31630 |
End posion on genome | 31556 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
ggtcgcaacg |
tRNA gene sequence |
GAGGCCGTAGCTCAGTCGGTTAGAGCACCTGGTTGTGGTCCAGGGGGTCGCGGGTTCGAA |
Downstream region at tRNA end position |
cggcgcgggc |
Secondary structure (Cloverleaf model) | >WENV170652349 His GTG g CCtt cggcgcgggc G - C A - T G - C G + T C - G C - G G - C T A T T G C C C A T G A A + | | | | G C C T C G G C G G G C G | | | | T T G G A G C T T A A GGGTC C - G C - G T - A G - C G - C T T T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |