Sequence ID | >WENV170652351 |
Genome ID | JRYH01001349 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 9915 |
End posion on genome | 9990 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
cccgctcgaT |
tRNA gene sequence |
TGCGGGGTAGAGCAGTCTGGTAGCTCGTCGGGCTCATAACCCGGAGGTCACAGGTTCGAA |
Downstream region at tRNA end position |
ccgagccggt |
Secondary structure (Cloverleaf model) | >WENV170652351 Met CAT T ATtc ccgagccggt T T G - C C - G G - C G - C G - C G - C T A T T G T C C A T G A A | | | | | G C C G A G A C A G G C T | | | | T T G G C T C G T A G AGGTC T + G C - G G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |