Sequence ID | >WENV170652355 |
Genome ID | JRYH01001407 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 64248 |
End posion on genome | 64320 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
gcggccgatc |
tRNA gene sequence |
GGGGCGGTAACTCAATTGGTAGAGTGCCAGCTTTGCAAGCTGGAAGTTGGGAGTTCGAGT |
Downstream region at tRNA end position |
cccgtcccgc |
Secondary structure (Cloverleaf model) | >WENV170652355 Ala TGC c Attg cccgtcccgc G - C G - C G + T G - C C - G G - C G - C T G T T C C T C A T A A A + | | | | G T C T C A G G G A G C G | | | | T T G G A G T T A G AAGTT C - G C - G A - T G - C C - G T A T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |