Sequence ID | >WENV170652357 |
Genome ID | JRYH01001436 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 1050 |
End posion on genome | 1125 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
gaaccgcgaT |
tRNA gene sequence |
GCGCCCGTAGCTCAACTGGATAGAGCGCAGGCCTCCGAAGCCTGAGGTTCCGCGTTCGAA |
Downstream region at tRNA end position |
agatcggcgc |
Secondary structure (Cloverleaf model) | >WENV170652357 Arg CCG T ATtc agatcggcgc G + T C - G G - C C - G C - G C - G G - C T A T G G C G C A C A A A | | | | | G T C T C G C C G C G C G | | | | T T G G A G C A T A G AGGTT C - G A - T G - C G - C C - G C A T A C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |