Sequence ID | >WENV170652358 |
Genome ID | JRYH01001436 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 18360 |
End posion on genome | 18431 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
cagacaccct |
tRNA gene sequence |
GCGGGTGTAGCTCAGTGGTAGAGCGTCACGTTGCCAACGTGAATGTCGTCGGTTCGAATC |
Downstream region at tRNA end position |
cgacgccggc |
Secondary structure (Cloverleaf model) | >WENV170652358 Gly GCC t Tttc cgacgccggc G - C C - G G - C G - C G - C T - A G - C T A T T A G C C A G A A + | | | | G T C T C G G T C G G C G | | | | T T G G A G C T A G ATGTC T - A C - G A - T C - G G - C T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |