Sequence ID | >WENV170652362 |
Genome ID | JRYH01001533 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 3760 |
End posion on genome | 3844 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
tacaaaaaaa |
tRNA gene sequence |
GCCGAAGTGGCGGAACTTGGTAGACGCGCTGGATTCAGGATCCAGTGGGTGAAAGCTCGT |
Downstream region at tRNA end position |
cttagcggaa |
Secondary structure (Cloverleaf model) | >WENV170652362 Leu CAG a Agag cttagcggaa G - C C - G C - G G - C A - T A - T G - C T A T C C C C C A T C A A G | | | | | A T G G C G G G G G G C G | | | T T G A C G C T A G G TGGGTGAAAGCTCGT C - G T - A G - C G - C A - T T A T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |