Sequence ID | >WENV170652370 |
Genome ID | JRYH01001644 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 29777 |
End posion on genome | 29863 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
tccgtgcgat |
tRNA gene sequence |
GCCGGAGTGGTGGAACTGGTAGACGCGCCGGACTCAAAATCCGGTGCCCGAGAGGGCGTG |
Downstream region at tRNA end position |
gaatgcggct |
Secondary structure (Cloverleaf model) | >WENV170652370 Leu CAA t ACCA gaatgcggct G - C C - G C - G G - C G - C A - T G - C T T T C G C C C A C A A G | | | | | G T G G T G G C G G G C G | + | T T G A C G C T A G G TGCCCGAGAGGGCGT C - G C - G G - C G - C A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |