Sequence ID | >WENV170652374 |
Genome ID | JRYH01001734 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 7014 |
End posion on genome | 6941 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
tcgacccgat |
tRNA gene sequence |
GCGGGTGTAGTTCAATGGTAGAACGGCAGCTTCCCAAGCTGCATACGAGGGTTCGATTCC |
Downstream region at tRNA end position |
catcaacttt |
Secondary structure (Cloverleaf model) | >WENV170652374 Gly CCC t TCCA catcaacttt G - C C - G G - C G - C G - C T - A G - C T T T T T C C C A A A A + | | | | G T C T T G G A G G G C G | | | | T T G G A A C T A G ATAC G - C C - G A - T G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |