Sequence ID | >WENV170652376 |
Genome ID | JRYH01001785 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 20845 |
End posion on genome | 20918 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
tctgccgaca |
tRNA gene sequence |
GGGCGGGTAGCTCAGTTGGCCAGAGCGTTCGCTTTACACGCGAAGGGTCCCGGGTTCGAG |
Downstream region at tRNA end position |
ggaagcggcg |
Secondary structure (Cloverleaf model) | >WENV170652376 Val TAC a Attc ggaagcggcg G - C G - C G - C C - G G - C G - C G - C T G T G G C C C A T G A A | | | | | G T C T C G C C G G G C G | | | | T T G G A G C C C A G GGGTC T - A T - A C - G G - C C - G T C T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |