Sequence ID | >WENV170652381 |
Genome ID | JRYH01001854 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 13255 |
End posion on genome | 13181 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
cgccgggcca |
tRNA gene sequence |
GGTCCCTTCGTCTATCGGTTAGGACGTCAGATTTTCAATCTGAAAAGACGGGTTCGACTC |
Downstream region at tRNA end position |
tgatatggct |
Secondary structure (Cloverleaf model) | >WENV170652381 Glu TTC a GCCA tgatatggct G - C G - C T - A C - G C - G C - G T - A T C T T G C C C A C T A C | | | | | G G T C T G A C G G G C G + | | | T T T G G A C T A G AAAG T - A C - G A - T G - C A - T T A T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |