Sequence ID | >WENV170652390 |
Genome ID | JRYH01002036 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 9158 |
End posion on genome | 9083 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
cggcccacat |
tRNA gene sequence |
GTCCCCGTCGTCTAGAGGCCTAGGACACCGCCCTTTCACGGCGGCGACACGGGTTCGAAT |
Downstream region at tRNA end position |
gggccggcag |
Secondary structure (Cloverleaf model) | >WENV170652390 Glu TTC t GCCA gggccggcag G - C T - A C - G C - G C - G C - G G - C T A T T G C C C A A G A C | | | | | G G T C T G A C G G G C G + | | | T T C G G A C C T A A CGAC C - G C - G G - C C - G C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |