Sequence ID | >WENV170652393 |
Genome ID | JRYH01002063 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 11168 |
End posion on genome | 11241 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
ttggcgtttt |
tRNA gene sequence |
GCGGGTGTAGCTCAATGGTAGAGCAGCAGCCTTCCAAGCTGAATACGTGGGTTCGATTCC |
Downstream region at tRNA end position |
acgctcgcct |
Secondary structure (Cloverleaf model) | >WENV170652393 Gly TCC t TCCA acgctcgcct G - C C - G G - C G - C G - C T - A G - C T T T T A C C C A A A A + | | | | G T C T C G G T G G G C G | | | | T T G G A G C T A A ATAC G A C - G A - T G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |