Sequence ID | >WENV170652396 |
Genome ID | JRYH01002087 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 3621 |
End posion on genome | 3547 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
gcggtcctga |
tRNA gene sequence |
CGGGGTGTAGCGCAGCTTGGTTAGCGCGCTTGACTGGGGGTCAAGAGGTCGGGAGTTCGA |
Downstream region at tRNA end position |
caatccaatc |
Secondary structure (Cloverleaf model) | >WENV170652396 Pro GGG a Attt caatccaatc C - G G - C G - C G - C G - C T - A G - C T A T C C C T C A T C G A A | | | | | G T C G C G G G G A G C G | | | | T T G G C G C T T A G AGGTC C - G T - A T - A G - C A - T C G T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |