Sequence ID | >WENV170652397 |
Genome ID | JRYH01002088 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 40368 |
End posion on genome | 40442 |
Amino Acid | Glu |
Anticodon | CTC |
Upstream region at tRNA start position |
ggccgcagac |
tRNA gene sequence |
GGCCCCATCGTCTAGCCCGGTCCAGGACACCAGGTTCTCATCCTGGGAACGGGGGTTCGA |
Downstream region at tRNA end position |
gaggcgggcg |
Secondary structure (Cloverleaf model) | >WENV170652397 Glu CTC c Attg gaggcgggcg G - C G + T C - G C - G C - G C - G A - T T A T C C C C C A C C G A C | | | | | G C T C T G G G G G G C G + | | | T T G G G A C T C C A A GAAC C - G C - G A - T G - C G - C T T T A C T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |