Sequence ID | >WENV170652398 |
Genome ID | JRYH01002088 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 38588 |
End posion on genome | 38514 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
gccgcgacct |
tRNA gene sequence |
GCGGGCGTAGCTCAACTGGATAGAGCACCTGACTACGGATCAGGAGGTTGAGGGTTCGAA |
Downstream region at tRNA end position |
gtgcgacccc |
Secondary structure (Cloverleaf model) | >WENV170652398 Arg ACG t GCtt gtgcgacccc G + T C - G G - C G - C G - C C - G G - C T A T C T T C C A C A A A | | + | | G T C T C G G A G G G C G | | | | T T G G A G C A T A A AGGTT C - G C - G T - A G - C A - T C A T G A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |